WormBase Tree Display for RNAi: WBRNAi00078100
expand all nodes | collapse all nodes | view schema
| WBRNAi00078100 | Homol | Homol_homol | C03D6:RNAi | ||
|---|---|---|---|---|---|
| F10G7:RNAi | |||||
| Sequence_info | DNA_text | tcaagttggagatcacatttgaagtttttgagcacttgccgcatgatctcgaatgggaattggtctacgtcggatccggaacatcccgagactttgaccaagttctcgattcagcgctcgttggtccaattccagaaggacgccacaagtttgtgttcgacgcggatcatccggatatctcgaagatcccagtcgatgatatcgtcggtgtcagcgtacttctcctgcgctgcaagtacaacgatcaggagtttatcaatatgggatggttcgtggcaaatgagtacaccgaggaagagctcaaagagaatcccccatcgcagccactcatcgaaa | |||
| Experiment | Laboratory | FN | |||
| Date | 11 Feb 2009 00:00:00 | ||||
| Genotype | asfl-1(tm874) | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F10G7.3 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006817 | Inferred_automatically | RNAi_primary | ||
| Transcript | F10G7.3.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000050626 | ||||
| Reference | WBPaper00032922 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | RNAi of unc-85 in the asfl-1(tm874) background resulted in 43.2 +/- 8.7 percent embryonic lethality compared to 11.2 +/- 2.8 for injection of unc-85 into wildtype. These results are consistent with the maternal contribution of Asf1 being necessary for embryonic development. | ||
| Method | RNAi |
