WormBase Tree Display for RNAi: WBRNAi00078102
expand all nodes | collapse all nodes | view schema
WBRNAi00078102 | Homol | Homol_homol | F25H2:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atgctgatctacaaggatattttcaccgatgatgagctctcgtccgactccttcccaatgaagttggttgatgatcttgtttacgaattcaagggaaagcacgttgtccgcaaggaaggagagatcgttttggctggatccaacccatctgctgaggaaggagccgaggatgatggatctgacgagcacgtcgagcgtggtatcgatattgtccttaaccacaagctcgttgagatgaactgct | |||
Experiment | Date | 17 Feb 2009 00:00:00 | |||
Strain | WBStrain00000001 | ||||
Treatment | RNAi-treated worms were examined microscopically over a period of 5 days for general phenotypic effects such as growth, development and movement. | ||||
Temperature | 25 | ||||
Delivered_by | Soaking | ||||
Inhibits | Predicted_gene | F25H2.11 | Inferred_automatically | RNAi_primary | |
Gene (2) | |||||
Transcript | F25H2.12b.2 | Inferred_automatically | RNAi_primary | ||
F25H2.11.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00032999 | ||||
Phenotype | WBPhenotype:0000154 | Remark | Reduced the numbers of eggs laid by the hermaphrodite in the F0 and F1 generations by 90 and 72 percent, respectively. | ||
Phenotype_not_observed | WBPhenotype:0000030 | ||||
WBPhenotype:0000518 | |||||
WBPhenotype:0000643 | |||||
Method | RNAi |