WormBase Tree Display for RNAi: WBRNAi00078821
expand all nodes | collapse all nodes | view schema
| WBRNAi00078821 | Evidence | Person_evidence | WBPerson428 | ||
|---|---|---|---|---|---|
| Homol | Homol_homol | F38A6:RNAi | |||
| Sequence_info | DNA_text | atgacatcgccatccagtgatgaggacattattgatataagggtcatcaaagaggagccagagtcggaacctgactctgaagccgagccagccacaaccacgaattcaacggattcagaagattctgtggaacaggaaaataaaaagttattggaaaccgagaagaatcgaaaacgcgagcagaaacataaaatgttgccaaatggaaccacttctgggacctccgacacgggaaatcaggtgcctgccacgtcgtcggctgcttcaagtgtagactatacggccatgaacgctcaggactatctgccgacgtattctaatactacgttaaactaccaaccatatcagtaccagactgctgccaatggacttctgaactacaacaactacagccagtatgccactgctaatcagctcggatcgaactacatcagcccagccaatttcatgcaaggaggaggaatttcacctcttggttttaccactggcaccaccggagccaccacagcggccgcttccgtggccacgtcgtccgcctcagcggtcatcggaagaagcaatggacgatcaagctcgacggttgctgcatcgccagccgataggtcttattctggtgtaagcggagggcaaggccaagaactcacgattcaggaatttgaaactgtcacggaaaagatcagaagacatggaacttatggacaatcgaaacctccatactcttacattagcttaattactatggcaattcaaaagtctaattctagacaattgacattgtctgaaatctacaattggatcatggatttgttcccttactatcagaacaatcaacaaagatggcaaaactcaattcgccactccctctccttcaatgattgctttgtaaaggttgccaggtcccctgacaagcctggaaagggatccttctggactcttcacgagcactgtgggaatatgtttgagaatggatgctacctccgtaggcagaagagattcaaggtcaaggaacgtgagccatcgagaaagaagagaaatgccaactcccaacaattgcatcaacaacaacacattccaaaaatggaaatcaaagaagaggatccaacatccatcacgaccacatcatcacttggtgcttattctctgatccctcaaatttctacaaagaaggagatcaaggaagagctgaaagctgtgcaagatgcaactgcagctgctgccaatcttggcctaattgacccatcgggaacgccgtcggctgttaatcacagtcaacctacttcagtgatctcaagtgttggcacactaggaaccacgcaagcacagatgacactcaatggtcaatacgcgtctccttacctctacagttcggattttgccacaattctcccacaatcccagaatttcctgaacaacacactctacaacacaacgagcagttatccaggaattgactacaccaacggagtataccagaatactctttacagctccaccaacccgaactcggccgccaacctataa | |||
| Experiment | Strain | WBStrain00007468 | |||
| Treatment | For optimal RNAi effect, worms were transferred onto freshly-induced RNA-expressing bacteria after every 24 hours. The effect of RNAi-induced gene silencing was visible in the F1 generation between 4 and 5 days. Note: In embryos experiencing pha-4 RNAi, the dynamics of movement, engulfment, and fusion by epidermal cells expressing reporters are more clearly visible (because of absence of bright pharyngeal cells), than in wild-type embryos with this reporter. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F38A6.1a | Inferred_automatically | RNAi_primary | |
| F38A6.1c | Inferred_automatically | RNAi_primary | |||
| F38A6.1b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004013 | Inferred_automatically | RNAi_primary | ||
| Transcript | F38A6.1c.1 | Inferred_automatically | RNAi_primary | ||
| F38A6.1b.1 | Inferred_automatically | RNAi_primary | |||
| F38A6.1a.1 | Inferred_automatically | RNAi_primary | |||
| DB_info | Database | Gloworm | Gloworm_Movie_Link | eff-1-gfp_x_pha-4rnai_projs_0Jau.mov | |
| eff-1-gfp_x_pha-4rnai_projs_1Jau.mov | |||||
| eff-1-gfp_x_pha-4rnai_projs_2Jau.mov | |||||
| eff-1-gfp_x_pha-4rnai_projs_3Jau.mov | |||||
| eff-1-gfp_x_pha-4rnai_projs_3Rau.mov | |||||
| eff-1-gfp_x_pha-4rnai_projs_4Jau.mov | |||||
| Species | Caenorhabditis elegans | ||||
| Phenotype | WBPhenotype:0000707 | Remark | RNAi blocked pharyngeal morphogenesis in these nematodes. | ||
| WBPhenotype:0001278 | Remark | There was a visible loss of pharyngeal eff-l::gfp expression in embryos and young larvae. | |||
| Remark | To see expression of eff-1::gfp in wildtype as a comparison, please view expression pattern Expr7312. | ||||
| Click the movie links for interactive 4D movies of the eff-1::gfp fluorescence reporter in the pha-4 RNAi background. In these stereo-4D movies the 3D embryo rotates around X & Y axes. | |||||
| Viewing movies in a browser requires the free QuickTime browser plugin, which runs on either Windows or MacOS. To control the QTVRs, click in the movie window and drag the mouse left-right to move forward through time, up-down to move through focus or rotation. A movie can also be animated step-wise with the keyboard arrow keys. Running animation and speed can be controlled by clicking on the edges of the movie window. | |||||
| An alternative to browser viewing is to right-click (or ctrl-click) a link above and download the movie file directly to your desktop. It can then be viewed in stand-alone application QuickTime Player. | |||||
| NOTE: QTVR movies are large, and may take several minutes to download in full. You can monitor the download by looking at the progress-status bar at the bottom left of your browser window. If viewing in your browser, the downloaded file will reside temporarily in the Cache or Temporary folder for you browser. To permanently save a local copy of the fully downloaded movie file, click on the bottom-right corner of the movie window and select Save as Quicktime Movie. | |||||
| Communicated by Bill Mohler prior to publication. | |||||
| Method | RNAi |
