WormBase Tree Display for RNAi: WBRNAi00079356
expand all nodes | collapse all nodes | view schema
WBRNAi00079356 | Homol | Homol_homol | K03B4:RNAi | |||
---|---|---|---|---|---|---|
T12D8:RNAi | ||||||
Sequence_info | DNA_text | aaatggcataaaaaaaacaaaattaaaaagttatgagtcaaaatcatcgtctggagctcttcgcttgagcatattctgtacatgctccggccgtagcacttgtgttggtggntcgatgatatgtggctgatgggtgacttgttgcatttccattggctgataactgtcgncagctttgnacacaaaattctgctgtaattgacagaatcgatcgntgggcagcttcaggncataattgtgtcgaatttgcggnaggggctgctgattggtgncanccgacaattggagaatcttctcacg | yk163f12.3 | |||
catgttggtatattataaattaggtgtgatatggtggacgagtgttctggtgtccgtattctttgagaatttcatcgagaagttcctctgtgagcgtgtattttgtgtctttcgttccttttttcgtctgtccgagacctttcatacgagcacttgtcatcgcgtcaagaataatatccgaaacatgtttttgagccgccagcgagatcattctagtcactcgcggatccgatccatcaacaccggcagacttcaagaagtgcaatgttacagaatcgggaatcgtcggcggatantcgg | yk331g8.3 | |||||
Sequence | yk163f12.3 | |||||
yk331g8.3 | ||||||
Experiment | Laboratory | LD | ||||
Date | 01 Aug 2001 00:00:00 | |||||
Genotype | end-1::gfp (from J. Rothman, unpublished) | |||||
Treatment | In vitro synthesized dsRNA was injected into young adults; for GFP analysis, embryos were collected from dissected hermaphrodites 24 h after injection | |||||
Delivered_by | Injection | |||||
Inhibits | Predicted_gene | K03B4.3a | Inferred_automatically | RNAi_primary | ||
K03B4.3b | Inferred_automatically | RNAi_primary | ||||
T12D8.7 | Inferred_automatically | RNAi_primary | ||||
Gene | WBGene00006391 | Inferred_automatically | RNAi_primary | |||
WBGene00006392 | Inferred_automatically | RNAi_primary | ||||
Transcript | T12D8.7.1 | Inferred_automatically | RNAi_primary | |||
K03B4.3b.1 | Inferred_automatically | RNAi_primary | ||||
K03B4.3a.1 | Inferred_automatically | RNAi_primary | ||||
Species | Caenorhabditis elegans | |||||
Reference | WBPaper00004890 | |||||
Phenotype_not_observed | WBPhenotype:0000306 | Remark | Expression of END-1::GFP indistinguishable from wild type | |||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
Remark | Probes only listed as yk163f12 and yk331g8 in paper, using yk163f12.3 and yk331g8.3 for curation; taf-10 and taf-11 in paper have since been renamed taf-9 and taf-10, respectively | |||||
Method | RNAi |