WormBase Tree Display for RNAi: WBRNAi00080871
expand all nodes | collapse all nodes | view schema
| WBRNAi00080871 | Homol | Homol_homol | F26D11:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | aggtagtcgaataatttggttttctgatacatctgaaatcttttttcaaattttcaaaaattacagttctttgtctataaaatctcacctaattgatcgagcattctacagccagagatactatcaggaaggcttgttagactgtttatgtcgacataaaactctcgtagacttgtgagttttcctatttcagccggcagtgcttcaagttcattttgtccaagatcgagctcttcaagttttctcaattccacaatcgacagaggaattgttcggagaagattgtctcgagcttcgagaactcgcagattcgtcagagatccaatgttagatggtaggagtgtcagacttgtctcgtttaaagacagaatagtgattgatgagcattcgcatatagtttcaggtaatctgaagtcaaaaaatgtttgaaaattattgaataatacaaatacttaccttgtgaacggattactgctcaagttcagcgttg | |||
| Experiment | Laboratory | OLB | |||
| Date | 19 Nov 2008 00:00:00 | ||||
| Treatment | Post-embryonic depletion, P0 generation scored. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F26D11.11f | Inferred_automatically | RNAi_primary | |
| F26D11.11c | Inferred_automatically | RNAi_primary | |||
| F26D11.11e | Inferred_automatically | RNAi_primary | |||
| F26D11.11d | Inferred_automatically | RNAi_primary | |||
| F26D11.11a | Inferred_automatically | RNAi_primary | |||
| F26D11.11b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002632 | Inferred_automatically | RNAi_primary | ||
| Transcript | F26D11.11b.1 | Inferred_automatically | RNAi_primary | ||
| F26D11.11f.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11e.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11c.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11d.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00032467 | ||||
| Phenotype | WBPhenotype:0000154 | ||||
| WBPhenotype:0000666 | |||||
| WBPhenotype:0000668 | Remark | The most proximal part of the gonad was inflated by trapped oocytes. | |||
| WBPhenotype:0000688 | Remark | Additional experiments in the rrf-1 background showed that sterility defect is mediated by depletion in the soma. | |||
| Penetrance | Complete | ||||
| Range | 100 | ||||
| Phenotype_not_observed | WBPhenotype:0000643 | ||||
| WBPhenotype:0000676 | |||||
| Method | RNAi |
