WormBase Tree Display for RNAi: WBRNAi00083932
expand all nodes | collapse all nodes | view schema
| WBRNAi00083932 | Homol | Homol_homol | K04D7:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gatgaagctcagtacgatgattcaacttgaagaagctgaaaagcggatcgctgatagtcaaaagaatagttgtggcggtcaaacaatatccgcattatcaaatgtttcgggtgattccaatgtagataataacggaacacacgagaaagaattgatgccttcaacgtcatcaattgatagtttggagtccataaacaatcaggaaacttcaaaatttccaagacctctaccaatgtctgatcaaccaacattgaacacttcgtgtcacattactaccacaacgtgttccgtgagttatgaagacgtcgacgttggcacactcaaaaaatcatatgttgaaataacagcaagtaaatatgaaacgaattcgaactcgtgtttctcgtatccgattcctccaacaccaggacgtcgatctcctgatgacttcgacgattatttcatggacttggagtcgaatagtcttatgtggcctcaaacaccgtatgctgttaccgatgaaaatccacagacaccacgagggttctctgcttctgaatcttctgaaccaatcgatttttcatcgctgggaaaagctacatcactggatactgaggagatcgttttccaatcaacatcatgccagagaccaatgggatactgttctgattttggagaattttcaaactcttcatcattacctgaagaaatacctgtaccttctcatcaaagaactccacaagaatcagcaattgaagatgattcgtctatgccaggtctcgatatggtaccattgtatgaggaagacgttgaggaatgtattattgaagatattgaagaagaagaggctccaattaaacaaggtcttgtcaattctagaccaccat | |||
| Experiment | Laboratory | EJ | |||
| Date | 06 Feb 2003 00:00:00 | ||||
| Genotype | gem-4(dx77) | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | K04D7.5a | Inferred_automatically | RNAi_primary | |
| K04D7.5b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00001653 | Inferred_automatically | RNAi_primary | ||
| Transcript | K04D7.5a.1 | Inferred_automatically | RNAi_primary | ||
| K04D7.5b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000051955 | ||||
| Reference | WBPaper00006177 | ||||
| Phenotype | WBPhenotype:0000691 | Remark | No suppression by gem-4(dx77) of the gonad defect caused by gon-4(RNAi). Authors state, therefore gon-4 is likely to act either downstream of gon-2 (and gem-4) or as part of a separate regulatory pathway required for the divisions of the gonadal precursors. | ||
| Method | RNAi |
