WormBase Tree Display for RNAi: WBRNAi00084826
expand all nodes | collapse all nodes | view schema
| WBRNAi00084826 | Homol | Homol_homol | W09C2:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgcattatcgtgatgctaactactctatatcccgaaataaagtgaatctacatcatgaagagtttatgttagatggagttgtcggtggcgaggaccatgatatgcagaacacgaatgaagtgcgtgcggagttggactctttgctccgtcttgatcctgacacaaactccatcattgatgctcttcatatttcacaaccaattgagcaggaaaacatggactacgaaggaaaacccgttgaatttactctcggcacttcttctggaggcgcatcactggcaccaacaagctcaacgacggctgcatccattgcaccattttcatacaatacatcagcaaccaactattacaacaccacaccgagtagttatccaatgttcctcaactatcaatatgctggaggcacaacagtgacaactgatatggatgcatttagtggaatggatatgtcaatgaataacggagtttttggaacacaaaacaatccgagttacttctatccaacgacacaactcaacacatatggatatgatacactcgccgctgccacgacagcatctggaattactgttaataacaatcaattgaatgttaatattgtacaaggaaatggaactatcgtaccacagccaatcactcaaaacatcatctccactgtttcaaatgttcaatcatcggttcctatcaataacagtcaacctctcaccccaactggattggctggctgctcgacgtcttcaggatcatcatcggcttcaagctcatcagcaaactcaacttctacaccgaagaacaccatctccaaagcaaaccgatcatcaggaggagccaacaattctcaattcagcacggaagatcgtgagtgtgtcaattgtggagttcacaatactccattatggcgtcgggatggatcaggaaactacctctgcaacgcatgcggcctctacttcaagatgaaccatcatgctcgtccattggtgaagccgaaaaagagacagcagaacgctcaaaaacggaccggaatcgagtgtgtcaactgtcgtacaaatacaacaacactctggagaagaaatggagaagggcatccagtgtgcaatgcttgtggactctactttaaacttcataaggtggaacgtccaatcaccatgaagaaggatggaattcagacccgtaatcgcaagctctccgcaaagggatcgcgaagaatgaagaaagagaatggcggaactccgacttcaatgggaatgcctacaacatcttcaagtatttcatctggaatcgaacttgatcaaagtggagtttggggaatgaaaaacactcaaccaatgctcatgacaccgacagcatatgcattcccagcatccaatttctacttcaactcgatcgaggatcaattggagtataaaacgtgccctccaatgatggtggactttggaggacaaatgaaaaatttgaatttgaactga | |||
| Experiment | Laboratory | RV | |||
| Date | 30 Jun 2009 00:00:00 | ||||
| Treatment | To bypass the embryonic requirement for elt-1, untreated embryos were hatched in the absence of food to obtain L1 larvae, then transferred to RNAi feeding plates. L4 larvae were picked onto individual fresh RNAi feeding plates to assess self-fertility. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | W09C2.1a | Inferred_automatically | RNAi_primary | |
| W09C2.1b | Inferred_automatically | RNAi_primary | |||
| W09C2.1d | Inferred_automatically | RNAi_primary | |||
| W09C2.1f | Inferred_automatically | RNAi_primary | |||
| W09C2.1c | Inferred_automatically | RNAi_primary | |||
| W09C2.1e | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00001249 | Inferred_automatically | RNAi_primary | ||
| Transcript | W09C2.1e.1 | Inferred_automatically | RNAi_primary | ||
| W09C2.1f.1 | Inferred_automatically | RNAi_primary | |||
| W09C2.1c.1 | Inferred_automatically | RNAi_primary | |||
| W09C2.1a.1 | Inferred_automatically | RNAi_primary | |||
| W09C2.1d.1 | Inferred_automatically | RNAi_primary | |||
| W09C2.1b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00034714 | ||||
| Phenotype | WBPhenotype:0000038 | Remark | Ruptured vulva phenotype observed in the majority (greater than 95%) of treated hermaphrodites. | ||
| WBPhenotype:0000154 | Remark | Scored non-ruptured animals. | |||
| WBPhenotype:0000357 | Remark | Scored non-ruptured animals. | |||
| WBPhenotype:0000387 | Remark | The pseudopod of sperm from elt-1 RNAi-treated animals is either absent or short and aberrantly shaped and the cells are unable to crawl. | |||
| WBPhenotype:0000509 | Remark | The pseudopod of sperm from elt-1 RNAi-treated animals is either absent or short and aberrantly shaped and the cells are unable to crawl. | |||
| WBPhenotype:0000688 | Remark | Scored non-ruptured animals. | |||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation (W09C2.1a). | ||||
| Method | RNAi |
