WormBase Tree Display for RNAi: WBRNAi00085206
expand all nodes | collapse all nodes | view schema
WBRNAi00085206 | Homol | Homol_homol | K01A2:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atgttctatttcctattggtccaatggagtaaagccgataatccagttctcacacattttcagattttctgcctggtgattattggaatcggatttttgattatcttgatcttaatattcagtatttttaaatccgaaatgaaaagtgactcacatgcaagacgattctttcatatttggccactggtacatatcgccttatccaccgcctatcagctcttcacgcaaattgtgatatctcattggaaaacttaccagatcccaatcctctactcatcctatgcaactaccgtctctgtttgcattcatttagttctgcactccatggcggttttttggaaagtataa | |||
Experiment | Laboratory | FDX | |||
Date | 30 Mar 2005 00:00:00 | ||||
Genotype | kvs-1::gfp | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | K01A2.8a | Inferred_automatically | RNAi_primary | |
K01A2.12 | Inferred_automatically | RNAi_primary | |||
K01A2.8d | Inferred_automatically | RNAi_primary | |||
K01A2.8c | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00086561 | Inferred_automatically | RNAi_primary | ||
WBGene00019282 | Inferred_automatically | RNAi_primary | |||
Transcript | K01A2.12.1 | Inferred_automatically | RNAi_primary | ||
K01A2.8d.1 | Inferred_automatically | RNAi_primary | |||
K01A2.8c.1 | Inferred_automatically | RNAi_primary | |||
K01A2.8a.1 | Inferred_automatically | RNAi_primary | |||
K01A2.8c.2 | Inferred_automatically | RNAi_primary | |||
K01A2.8c.3 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00025063 | ||||
Phenotype | WBPhenotype:0001278 | Remark | GFP fluorescence of the transgene in ADF neurons is reduced with this RNAi. | ||
Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation (K01A2.8c.1). | ||||
Method | RNAi |