WormBase Tree Display for RNAi: WBRNAi00087264
expand all nodes | collapse all nodes | view schema
| WBRNAi00087264 | Homol | Homol_homol | F13B10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgtgtgccctagtctcatctccaatggtttcactaccgtttaatgagaacgttgcccctgaatgcagacgtaacctgcttccaagattcgctgcagtctcgccaagacctaaagcagcagttacgccattcgtgagcacaccctcttcgtcgtctattacttcatttccttattctctaaaactttcaaattccaattcaaactgttcaagtctctcaagaccatccagtctcacagatcttccgatcttattacgagacgtagaggatcagatgtacgatgacgatgagacgcctataattccatgcggatcaccatcgtccagcaattccatgctggcacagattcaattccatccacctccaactgagatgaacagtccattaaagacttccttaaagaagcttcccatgaaaactgcactagttatccgaccacaaatgttcgtcaaggagaacagtgtgcagttggagagattccgaaagtccaaaactcgccgattcttccacccgtatgcaaag | |||
| Experiment | Laboratory | IG | |||
| Date | 22 Feb 2008 00:00:00 | ||||
| Genotype | frIs7 (nlp-29::GFP, col-12::dsRed) | ||||
| Treatment | RNAi feeding experiments were performed with L4 stage synchronized worms at 20 or 25 degrees Celsius; 24 hr later, worms were infected with D. coniospora or wounded. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F13B10.1b | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006575 | Inferred_automatically | RNAi_primary | ||
| Transcript | F13B10.1d.3 | Inferred_automatically | RNAi_primary | ||
| F13B10.1b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000517744 | ||||
| Reference | WBPaper00031666 | ||||
| Phenotype | WBPhenotype:0001278 | Remark | Expression of the nlp-29::GFP transgene in response to both infection by D. coniospora and wounding was significantly reduced after tir-1 b(RNAi) | ||
| Method | RNAi |
