WormBase Tree Display for RNAi: WBRNAi00087270
expand all nodes | collapse all nodes | view schema
| WBRNAi00087270 | Homol | Homol_homol | F11E6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | caagtccagcagccacgctcgtcgatgttttgacaaaaccatggagtctggatcagactgattcttacatgtctacatttgtaccattatcctataaaatcatgattggttatctcgtcaccatctacttcgggcaaaaattaatggctcacagaaaaccattcgatctccaaaatacacttgctctctggaacttcgggttttcactgttctcgggaatcgccgcctataagcttattccagaactattcggagttttcatgaaggacgggtttgtcgcttcctactgtcaaaacgagaactactacaccgatgcatcaactggattctggggctgggcctttgtgatgtcga | |||
| Experiment | Date | 02 Apr 2008 00:00:00 | |||
| Genotype | Psod-3::GFP; lin-15(n765) | ||||
| Treatment | Psod-3::gfp worms were bred on RNAi plates for 72 h, and observed under fluorescence microscope (DMRXA, Leica) after fixation by paraformaldehyde | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F11E6.5 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001240 | Inferred_automatically | RNAi_primary | ||
| Transcript | F11E6.5.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000503602 | ||||
| Reference | WBPaper00031804 | ||||
| Phenotype | WBPhenotype:0001236 | Remark | Expression of the sod-3::GFP transgene increased modestly upon elo-2(RNAi) | ||
| Method | RNAi |
