WormBase Tree Display for RNAi: WBRNAi00087435
expand all nodes | collapse all nodes | view schema
WBRNAi00087435 | Homol | Homol_homol | F09E5:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | tgtcgaaagcattcatcggaaagccagctccacaattcaagactcaagccgtcgttgatggcgagttcgttgatgtttcgctctctgactacaagggaaaatacgttgtgctcttcttctacccacttgacttcactttcgtgtgcccaaccgagattatcgccttctctgaccgtgctgaggagttcaaggctatcaacaccgttgtgctcgccgcttccaccgactctgtcttctctcacttggcatggatcaaccagccacgcaagcacggaggactcggagagatgaacattccagttctcgctgacaccaaccaccaaatctcccgtgattacggagttctcaaggaggacgaaggaattgctttccgtggactcttcatcatcgacccatcacaaaacctccgtcaaatcaccatcaatgatcttccagtcggacgctctgttgatgagactcttcgtcttgttcaggccttccagttcgtcgagaagcacggagaggtttgcccagctggatggactccaggatccgacaccatcaagccaggagtcaaagaaagccaagagtacttcaagaagcactaa | |||
Experiment | Laboratory | VE | |||
Date | 16 Oct 2008 00:00:00 | ||||
Genotype | gcs-1::GFP | ||||
Treatment | L4-stage worms were placed on prdx-2 RNAi plates; F1 progeny were scored for intestinal GFP expression | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | F09E5.15c | Inferred_automatically | RNAi_primary | |
F09E5.15b | Inferred_automatically | RNAi_primary | |||
F09E5.15a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00006434 | Inferred_automatically | RNAi_primary | ||
Transcript | F09E5.15b.1 | Inferred_automatically | RNAi_primary | ||
F09E5.15a.1 | Inferred_automatically | RNAi_primary | |||
F09E5.15c.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000503847 | ||||
Reference | WBPaper00032399 | ||||
Phenotype | WBPhenotype:0001236 | Remark | prdx-2(RNAi) resulted in increased levels of expression of the gcs-1::GFP transgene | ||
Method | RNAi |