WormBase Tree Display for Strain: WBStrain00005103
expand all nodes | collapse all nodes | view schema
| WBStrain00005103 | Status | Live | ||
|---|---|---|---|---|
| Genotype | smg-1(cc546) I; dvIs179. | |||
| Public_name | CL2179 | |||
| Contains | Gene | WBGene00004879 | ||
| Variation | WBVar00051557 | |||
| Transgene | WBTransgene00005745 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | Gamma Irradiation | |||
| CGC_received | 16 Dec 2014 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson376 | |||
| Remark | Mutagen:Gamma radiation | Curator_confirmed | WBPerson1983 | |
| dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] | Inferred_automatically | From CGC strain data | ||
| Species | Caenorhabditis elegans |
