WormBase Tree Display for Strain: WBStrain00033373
expand all nodes | collapse all nodes | view schema
| WBStrain00033373 | Status | Live | ||
|---|---|---|---|---|
| Genotype | unc-17(cn355) IV. | |||
| Public_name | RM523 | |||
| Contains | Gene | WBGene00006756 | ||
| Variation | WBVar00054257 | |||
| Properties | Outcrossed | x>3 | ||
| CGC_received | 13 May 2019 00:00:00 | |||
| 18 Oct 2023 00:00:00 | ||||
| Location | CGC | |||
| Made_by | WBPerson508 | |||
| Remark | cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37. | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
