WormBase Tree Display for Strain: WBStrain00037959
expand all nodes | collapse all nodes | view schema
| WBStrain00037959 | Status | Live | ||
|---|---|---|---|---|
| Genotype | F31D5.1(gk770) gkDf13 unc-4(e120) II. | |||
| Public_name | VC10067 | |||
| Contains | Gene | WBGene00006744 | ||
| WBGene00017944 | ||||
| Variation | WBVar00146084 | |||
| WBVar00142975 | ||||
| Rearrangement | gkDf13 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | UV+TMP | |||
| CGC_received | 16 Dec 2009 00:00:00 | |||
| Location | CGC | |||
| Remark | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |
| This strain is homozygous for two deletions plus unc-4(e120). The deletions were identified by comparative genome hybridization (CGH) of a mutangenized unc-4 line against N2. The deletion gk770 was confirmed by PCR and sequencing of the amplification product, and is detectable using the following primers. Left primer: GCGCATTTGCAACATCTCTA. Right primer: AACCTCAACGGAAACACTGG. WT amplicon: 1087 bp. Deletion size: 142 bp. Deletion left flank: CAGGTGAGCTTAAGCAGATTTTTTTTTGAA. Deletion right flank: GTGAGCCAAGTTAAACATTTGAAAATAATT. Insertion Sequence: GTGAGCCAAGTTGAACATTTGAAAATAAT. The deletion gkDf13 was not confirmed by PCR. CGH data indicates a maximum size of 7801 bp and a minimum size of 1357 bp. Left flanking probe: GTTTTATCTTTCGGCTTATTCAGAATAAATTATTGGTTCAGTTGTTTCAG. Left deleted probe: AGGAGAAGGAGATAAATGGTCTTGTAGACTGCGCAGCTAGGGAGAGAGAA. Right deleted probe: GAAGTTCTGAAGATTCAATTTTCAGTCTTACAATATTCAGTTCTCGTGTA. Right flanking probe: GTTGAATTTATTCGAATTTTGCAATTTCAGCAAAACACCTTTATCTTGGA. | Inferred_automatically | From CGC strain data | ||
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
| Species | Caenorhabditis elegans |
