WormBase Tree Display for Strain: WBStrain00037968
expand all nodes | collapse all nodes | view schema
WBStrain00037968 | Status | Live | ||
---|---|---|---|---|
Genotype | unc-4(e120) mix-1(gk803) II. | |||
Public_name | VC10079 | |||
Contains | Gene | WBGene00003367 | ||
WBGene00006744 | ||||
Variation | WBVar00146110 | |||
WBVar00142975 | ||||
Properties | Outcrossed | x0 | ||
Mutagen | UV+TMP | |||
CGC_received | 03 Jun 2009 00:00:00 | |||
Location | CGC | |||
Remark | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |
M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). | Inferred_automatically | From CGC strain data | ||
Made_by: Vancouver KO Group | CGC_data_submission | |||
Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
Species | Caenorhabditis elegans |