WormBase Tree Display for Strain: WBStrain00037971
expand all nodes | collapse all nodes | view schema
WBStrain00037971 | Status | Live | ||
---|---|---|---|---|
Genotype | let-19(gk908) unc-4(e120) II. | |||
Public_name | VC10110 | |||
Contains | Gene | WBGene00002295 | ||
WBGene00006744 | ||||
Variation | WBVar00146177 | |||
WBVar00146309 | ||||
WBVar00142975 | ||||
Properties | Outcrossed | x0 | ||
Mutagen | UV+TMP | |||
CGC_received | 03 Jun 2009 00:00:00 | |||
Location | CGC | |||
Remark | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |
K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). | Inferred_automatically | From CGC strain data | ||
Made_by: Vancouver KO Group | CGC_data_submission | |||
Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
Species | Caenorhabditis elegans |