WormBase Tree Display for Strain: WBStrain00047453
expand all nodes | collapse all nodes | view schema
WBStrain00047453 | Evidence | Curator_confirmed | WBPerson1983 | |
---|---|---|---|---|
Status | Live | |||
Genotype | +/mT1[umnIs52] II; K12H4.5(ve547[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. | |||
Public_name | RG3047 | |||
Contains | Gene | WBGene00001072 | ||
WBGene00003514 | ||||
WBGene00004496 | ||||
WBGene00006789 | ||||
Variation | WBVar00142982 | |||
WBVar02154134 | ||||
Rearrangement | mT1 | |||
Transgene | WBTransgene00033218 | |||
Properties | Mutagen | CRISPR_Cas9 | ||
CGC_received | 12 Jun 2019 00:00:00 | |||
Location | CGC | |||
Remark | umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous lethal. Deletion of 418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal GFP+ non-mKate2 (ve547 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaattaattaatttataatgtgatcctttt ; Right flanking sequence: agtcgtagacgattttcgattttcactgta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: RG KO Group | CGC_data_submission | |||
Species | Caenorhabditis elegans |