WormBase Tree Display for Strain: WBStrain00049366
expand all nodes | collapse all nodes | view schema
WBStrain00049366 | Evidence | Curator_confirmed | WBPerson1983 | |
---|---|---|---|---|
Status | Live | |||
Genotype | rpt-5(ve627[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. | |||
Public_name | RG3127 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004496 | ||||
WBGene00004505 | ||||
WBGene00006778 | ||||
WBGene00006789 | ||||
Variation | WBVar02154185 | |||
WBVar00143077 | ||||
Rearrangement | hT1 | |||
Transgene | WBTransgene00033224 | |||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 03 Aug 2020 00:00:00 | |||
Location | CGC | |||
Remark | Made_by: RG KO Group | CGC_data_submission | ||
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Larval lethal w/ escapers that show pleiotropic phenotypes. Deletion of 1521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae with occasional escapers (ve627 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gattcaaagggaacacagtgacaaccggga ; Right flanking sequence: tctggggcctgaaaattagttgtaattgct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | ||
Species | Caenorhabditis elegans |