WormBase Tree Display for Strain: WBStrain00051686
expand all nodes | collapse all nodes | view schema
| WBStrain00051686 | Status | Live | ||
|---|---|---|---|---|
| Genotype | muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. | |||
| Public_name | GLW27 | |||
| Contains | Gene | WBGene00001946 | ||
| WBGene00006843 | ||||
| Variation | WBVar00145093 | |||
| Transgene | WBTransgene00032981 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 21 Dec 2021 00:00:00 | |||
| Location | CGC | |||
| Remark | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26 | Inferred_automatically | From CGC strain data | |
| Made_by: Ella DeMott (Glow Worms '20) | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
