WormBase Tree Display for Strain: WBStrain00051927

WBStrain00051927 Status: Live
  Genotype: +/mT1 [umnIs52] II; C14B9.10(gk5476[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III.
  Public_name: RG5032
  Contains: Gene: WBGene00001072
      WBGene00003514
      WBGene00004496
      WBGene00006789
    Variation: WBVar00142982
    Rearrangement: mT1
    Transgene: WBTransgene00033218
  Properties: Mutagen: CRISPR_Cas9
    CGC_received: 04 Jan 2022 00:00:00
  Location: CGC
  Remark: umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5476 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4398 and CGC66. gk5476 is a 1853 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACCAAACCGTCAGACATGCTGCGTCTCCT; Right flanking sequence: AACTGGCAAGAAATGGTTCCGCATTGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Inferred_automatically: From CGC strain data
    Made_by: Morgan Zaic CGC_data_submission
  Species: Caenorhabditis elegans