WormBase Tree Display for Strain: WBStrain00055421
expand all nodes | collapse all nodes | view schema
| WBStrain00055421 | Genotype | T01B7.5(ve771[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | ||
|---|---|---|---|---|
| Public_name | RG3271 | |||
| Contains | Gene | WBGene00001072 | ||
| WBGene00003514 | ||||
| WBGene00004496 | ||||
| WBGene00006787 | ||||
| WBGene00006789 | ||||
| Variation | WBVar00142982 | |||
| WBVar00143214 | ||||
| Rearrangement | mnC1 | |||
| Transgene | WBTransgene00024167 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 22 Mar 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous early larval arrest. Deletion of 3511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve771 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattgctaatttttggatttcagatacta ; Right flanking sequence: gttgaatgtgtttttgtgtgcccggtcact. sgRNA #1: gaactATGTCATCAAGGAAG; sgRNA #2: cgactaaaagggcaaacgag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
