WormBase Tree Display for Strain: WBStrain00055522
expand all nodes | collapse all nodes | view schema
WBStrain00055522 | Genotype | +/mT1 [umnIs52] II; unc-116(gk5722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. | ||
---|---|---|---|---|
Public_name | RG5041 | |||
Contains | Gene | WBGene00001072 | ||
WBGene00003514 | ||||
WBGene00004496 | ||||
WBGene00006789 | ||||
WBGene00006840 | ||||
Variation | WBVar00142982 | |||
Rearrangement | mT1 | |||
Transgene | WBTransgene00033218 | |||
Properties | Mutagen | CRISPR_Cas9 | ||
CGC_received | 18 Apr 2022 00:00:00 | |||
Location | CGC | |||
Remark | umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5722 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4653 and CGC66. gk5722 is a 2264 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTTTGAAATGACGGATTTTTGGACCACAT; Right flanking sequence: CCCGGCTTCTCCTTACAATGCCTGCAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: Morgan Zaic | CGC_data_submission | |||
Species | Caenorhabditis elegans |