WormBase Tree Display for Strain: WBStrain00055525
expand all nodes | collapse all nodes | view schema
| WBStrain00055525 | Genotype | gex-3(gk5235[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/ nT1 V | ||
|---|---|---|---|---|
| Public_name | RG5044 | |||
| Contains | Gene | WBGene00001580 | ||
| WBGene00003514 | ||||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| Rearrangement | nT1 | |||
| Transgene | WBTransgene00033215 | |||
| Properties | Mutagen | CRISPR_Cas9 | ||
| CGC_received | 18 Apr 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5235 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4152 and CGC63. gk5235 is a 2546 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC; Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: Morgan Zaic | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
