WormBase Tree Display for Strain: WBStrain00055740
expand all nodes | collapse all nodes | view schema
| WBStrain00055740 | Genotype | coh-4(tm1857) coh-3(gk112)/tmC16 [unc-60(tmIs1210)] coh-3(gk112) V. | ||
|---|---|---|---|---|
| Public_name | ZT73 | |||
| Contains | Gene | WBGene00000592 | ||
| WBGene00006794 | ||||
| WBGene00021560 | ||||
| Variation | WBVar00250821 | |||
| WBVar00145519 | ||||
| Rearrangement | tmC16 | |||
| Transgene | WBTransgene00024744 | |||
| Properties | Outcrossed | x1 | ||
| Mutagen | UV+TMP | |||
| CGC_received | 08 Sep 2023 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson1503 | |||
| Remark | Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
