WormBase Tree Display for Transgene: WBTransgene00000612
expand all nodes | collapse all nodes | view schema
| WBTransgene00000612 | Public_name | hpIs98 | |
|---|---|---|---|
| Summary | [unc-80(+); unc-80::mRFP; odr-1::GFP] | ||
| Construction | Construct | WBCnstr00000610 | |
| Integration_method | UV | ||
| Construction_summary | hpIs98 was created with three unc-80::gfp constructs: pJH983+pJH984+pJH916. pJH983, amplified with an oligo pair OZM967 (5'CCTGTCGACGTAGGTGACTTTCCGAGCTGCCA3')/OZM973 (5'AGAGCTGATAGTCCCACTCTTCGAAACGGA3'), contains 3.6kb sequence immediately upstream of the predicted ATG start codon shared by F25C8.3a and b isoforms followed by 6.8kb of N-terminal genomic sequence for all predicted F25C8.3 open reading frames. pJH984, amplified with an oligo pair OZM594 (5'AAGGGCCCAATGCATGTT CGATACTTACAGCAC3')/OZM679 (5'CGTGGTGAATCTTCCTCTGTGGCAG3'), contains 9.8kb of genomic sequence starting from the predicted ATG start codon of F25C8.3 open reading frames. pJH985, amplified by an oligo pair OZM554 (5'TCCGTTTCGAAG AGTGGGACTATCAGCTCT3')/OZM555 (5'GTTCGAATAGAATTGGTGGCCGTGT TTACCC3'), contains 12.1kb of the C-terminal portion of the predicted F25C8.3 genomic sequence followed by 2.7kb of downstream sequence. Fragments pJH983-pJH984, as well as pJH984-pJH985, overlap by 3kb in genomic sequence. pJH916 is a PCR-generated DNA fragment containing the same last 12.1kb C-terminal genomic sequence as pJH985 with mRFP (cherry) sequence inserted immediately before the stop codon, followed by unc-54 3'-UTR sequence. | ||
| Genetic_information | Integrated | ||
| Used_for | Expr_pattern | Expr8061 | |
| Interactor | WBInteraction000503537 | ||
| Associated_with | Strain | WBStrain00046863 | |
| Reference | WBPaper00031592 | ||
| WBPaper00042167 | |||
| Species | Caenorhabditis elegans |
