WormBase Tree Display for Transgene: WBTransgene00004715
expand all nodes | collapse all nodes | view schema
| WBTransgene00004715 | Public_name | syIs202 | |
|---|---|---|---|
| Summary | [vang-1::YFP + myo-2::DsRed + unc-119(+)] | ||
| Synonym | [vang-1::YFP] | ||
| Construction | Construct | WBCnstr00004697 | |
| Construction_summary | The construct contains vang-1 genomic DNA amplified with forward primer TTCTACCGGTGTGGAATAGGAAACCTGAAATTATGAATTATG and reverse primer CCAATCGTATGGCCGTTAATTAAGATACGCTTAAAGCTGG and includes coding sequence up to the beginning of the 5th exon and 3kb of sequence 5' of ATG. --precise ends. | ||
| Genetic_information | Integrated | ||
| Used_for | Expr_pattern | Expr8334 | |
| Associated_with | Strain | WBStrain00030968 | |
| Reference | WBPaper00032129 | ||
| WBPaper00059953 | |||
| Species | Caenorhabditis elegans |
