WormBase Tree Display for Transgene: WBTransgene00005182

WBTransgene00005182 Public_name: zcIs9
  Summary: [hsp-60::GFP]
  Synonym: [hsp-60::gfp; lin-15(+)]
  Construction: Construct: WBCnstr00005159
    Coinjection_other: pSK1[lin-15(+)]
    Integration_method: UV_TMP
  Construction_summary: The hsp-60::gfp reporter was constructed by ligating a 2.3 kb SalI-BamHI PCR fragment derived by amplification of C. elegans genomic DNA with the primers: CeHSP10.6AS (AA- GAGTCGACTCGCGGAAGATTGAGTATTCC) and CeHSP60.2AS (CTGAGGATCCTTTCTGGCGAGGGGAAGCATC) into pPD95.75. hsp-60::gfp contains the 5' flanking region and encodes the predicted first 7 amino acids of HSP-60 fused to GFP.
  Genetic_information: Integrated
    Map: V
    Phenotype: WBPhenotype:0001236 Paper_evidence: WBPaper00061762
        Curator_confirmed: WBPerson712
        Remark: "Using a similar dose range, we found that one intermediate dose was sufficient to activate UPRmt signaling, assayed through the characterized transcriptional hsp-60 reporter strain (Melber and Haynes 2018; Rolland et al. 2019) (Figure 1C)." Paper_evidence: WBPaper00061762
            Curator_confirmed: WBPerson712
          Paraquat, a known UPRmt positive control (Kim and Sieburth 2018), was used to confirm our results with FCCP. This study was repeated on at least 3 independent days. Paper_evidence: WBPaper00061762
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00007723 Paper_evidence: WBPaper00061762
              Curator_confirmed: WBPerson712
            WBMol:00002747 Paper_evidence: WBPaper00061762
              Curator_confirmed: WBPerson712
        Phenotype_assay: Strain: WBStrain00034066 Paper_evidence: WBPaper00061762
              Curator_confirmed: WBPerson712
      WBPhenotype:0001719 Paper_evidence: WBPaper00061762
        Curator_confirmed: WBPerson712
        Remark: "Using a similar dose range, we found that one intermediate dose was sufficient to activate UPRmt signaling, assayed through the characterized transcriptional hsp-60 reporter strain (Melber and Haynes 2018; Rolland et al. 2019) (Figure 1C)." Paper_evidence: WBPaper00061762
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00007723 Paper_evidence: WBPaper00061762
              Curator_confirmed: WBPerson712
        Phenotype_assay: Strain: WBStrain00034066 Paper_evidence: WBPaper00061762
              Curator_confirmed: WBPerson712
  Used_for: Expr_pattern: Expr11758
    Marker_for: UPR(mt)
    Interactor (112)
  Associated_with: Strain: WBStrain00034066
  Reference (55)
  Species: Caenorhabditis elegans