WormBase Tree Display for Transgene: WBTransgene00017614
expand all nodes | collapse all nodes | view schema
| WBTransgene00017614 | Public_name | WBPaper00041705Ex1 | |
|---|---|---|---|
| Summary | [Prig-6::RIG-6::GFP] | ||
| Synonym | Expr10584_Ex | ||
| Construction | Construct | WBCnstr00017011 | |
| Construction_summary | GFP was fused at the carboxy terminus of the RIG-6 protein. The translational fusion encompasses the C33F10.5d isoform sequence, excluding the stop codon, and 2.1 kb of upstream sequence. Since all the isoforms share the same last exon, the cloning of the sequence of the largest isoform ensures that the 5 isoforms are simultaneously expressed under their endogenous promoter in fusion with GFP. The sequence was amplified by PCR from N2 genomic DNA, in two fragments. The two partially overlapping fragments were cloned sequentially into SacII-NotI and NotI-SalI sites of pBluescript KS. The primers that we used incorporated the appropriate restriction enzymes sites for the subcloning. The primers used for the first fragment are: 5'CCCCCGCGGTAAACTGAAACTTTGATTTACA3' and 5' GAATGCGGCCGCCTTTGGCTAATCACGATTGA3' while for the second fragment are 5'GAATGCGGCCGCAGATTTATGTAGGTGCCCATCAT and 5' CCGCGTCGACGAGTCTCCATAGTAATAATAACA3'. In a third step the plasmid was digested with AfeI and self-ligated. Finally the SacII blunted-SalI fragment was subcloned into the HindIII filled in- SalI sites of the pPDB95.77 vector (Fire et al., 1990). | ||
| Genetic_information | Extrachromosomal | ||
| Used_for | Expr_pattern | Expr10584 | |
| Reference | WBPaper00041705 | ||
| Species | Caenorhabditis elegans |
