WormBase Tree Display for Feature: WBsf027925
expand all nodes | collapse all nodes | view schema
| WBsf027925 | SMap | S_parent | Sequence | T07C4 | |
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ctcccgaatgtcatccacaaaccccgactc | gaaacagattttcactgcctgggggcatca | ||
| Mapping_target | T07C4 | ||||
| DNA_text | gtaacgctgctcc | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | Transcription factor binding site | |||
| SO_term | SO:0000235 | ||||
| Defined_by | Defined_by_paper | WBPaper00028561 | |||
| Associations | Associated_with_gene | WBGene00000423 | |||
| Associated_with_operon | CEOP3666 | ||||
| Associated_with_Interaction | WBInteraction000521640 | ||||
| Associated_with_expression_pattern | Expr4230 | Paper_evidence | WBPaper00028561 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000104 | ||||
| Bound_by_product_of | WBGene00001204 | ||||
| WBGene00003938 | |||||
| Remark | Binding to element by EGL-38 or PAX-2 has been demonstrated in vivo but not in vitro i.e. the element may be necessary, but not sufficient for binding | Person_evidence | WBPerson96 | ||
| Method | TF_binding_site |
