WormBase Tree Display for Feature: WBsf034245
expand all nodes | collapse all nodes | view schema
| WBsf034245 | SMap | S_parent | Sequence | ZK1127 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | atctacgcatcatccgaagattctttctag | ttgtccacgtaacaacttgtgctttttcgt | |
| Mapping_target | ZK1127 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | nos-2 3'UTR | ||
| SO_term | SO:0000409 | |||
| Defined_by | Defined_by_paper | WBPaper00031702 | ||
| Associations | Associated_with_gene | WBGene00003784 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000115 | |||
| Bound_by_product_of | WBGene00003229 | |||
| WBGene00003864 | ||||
| WBGene00003865 | ||||
| WBGene00004984 | ||||
| WBGene00004078 | ||||
| Remark | MEX-3 and SPN-4 suppress the translation of nos-2 mRNA by directly binding to nos-2 3'UTR. OMA-1 and OMA-2 suppress nos-2 translation in oocytes by directly binding to the SubE region of nos-2 3'UTR. POS-1 activates nos-2 translation in P4 by competing out SPN-4 for binding to nos-2 3'2UTR | Paper_evidence | WBPaper00031702 | |
| Method | TF_binding_site_region |
