WormBase Tree Display for Feature: WBsf034358
expand all nodes | collapse all nodes | view schema
| WBsf034358 | SMap | S_parent | Sequence | R13A5 |
|---|---|---|---|---|
| Name | Public_name | Region III | ||
| Sequence_details | Flanking_sequences | ttttgcagaaacggaaagagctcttgttagcgc | agccgtgactgattgatcgtattatcaaaacaca | |
| Mapping_target | R13A5 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Region which includes a binding site for LIN-1 | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00029329 | ||
| Associations | Associated_with_gene | WBGene00003024 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000135 | |||
| Bound_by_product_of | WBGene00002990 | |||
| Remark | This 198bp promoter region is ~5.5kb upstream of lin-39. | Paper_evidence | WBPaper00029329 | |
| ChIP experiments confirmed in vivo binding of LIN-1GFP to the lin-39 promoter fragments III and IV (Fig. 2B). LET-418 and LIN-1, are required for the negative control of the lin-39 activity. [2013-07-23 gw3] | ||||
| Method | TF_binding_site_region |
