WormBase Tree Display for Feature: WBsf038803
expand all nodes | collapse all nodes | view schema
WBsf038803 | SMap | S_parent | Sequence | R07D5 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | cgcttcctttgaaatcgtagtacatttcaag | atctcttgaatttgaatatgtgaggtgatc | |
Mapping_target | R07D5 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_sequence | late_embryo_20dC_4.5hrs_post-early_embryo_bundle_of_reads_supporting_SL1_X_15125418_15125419_-_wb170 | ||
lin-35_n745_mid-L1_25dC_4.0hrs_post-L1_bundle_of_reads_supporting_SL1_X_15125418_15125419_-_wb170 | ||||
Defined_by_paper | WBPaper00033138 | |||
Defined_by_analysis | RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 | 1 | ||
RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 | 3 | |||
RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 | 5 | |||
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 2 | |||
RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 | 3 | |||
Remark | [090825 pad] SL1 has been annotated based on co-ordinates reported in paper. | Paper_evidence | WBPaper00033138 | |
Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 3 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 5 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 3 reads | ||||
Method | SL1 |