WormBase Tree Display for Feature: WBsf039936
expand all nodes | collapse all nodes | view schema
WBsf039936 | SMap | S_parent | Sequence | CHROMOSOME_III |
---|---|---|---|---|
Name | Other_name | CL-438_2 | ||
Sequence_details | Flanking_sequences | ATATTAGCGCTAAAACAGGAAAAAAATGAT | TTTGAAGAGTTTGCTGAAATTAAACATTTT | |
Mapping_target | CHROMOSOME_III | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Polymorphic segmental duplication as defined by the tool OrthoCluster. This feature represents one sequence from a pair of duplicons in the N2 genome. | ||
SO_term | SO:0000457 | |||
Defined_by | Defined_by_paper | WBPaper00034747 | ||
Defined_by_analysis | Vergara_OrthoCluster_duplication | |||
Associations | Associated_with_Feature | WBsf039375 | ||
Remark | [090904 pad] Annotated this feature based on published data. | Paper_evidence | WBPaper00034747 | |
Method | segmental_duplication |