WormBase Tree Display for Feature: WBsf040347
expand all nodes | collapse all nodes | view schema
WBsf040347 | SMap | S_parent | Sequence | Y54G2A | |
---|---|---|---|---|---|
Name | Other_name | CL-1478_1 | |||
Sequence_details | Flanking_sequences | AGTCCTAACAACCAAAATTGCAGATAATTG | AGTTTAAGCCTGTAAAACTATTTTGGAATA | ||
Mapping_target | Y54G2A | ||||
Origin | Species | Caenorhabditis elegans | |||
Visible | Description | Polymorphic segmental duplication as defined by the tool OrthoCluster. This feature represents one sequence from a pair of duplicons in the N2 genome. | |||
SO_term | SO:0000457 | ||||
Defined_by | Defined_by_paper | WBPaper00034747 | |||
Defined_by_analysis | Vergara_OrthoCluster_duplication | ||||
Associations | Associated_with_Feature | WBsf042083 | Paper_evidence | WBPaper00034747 | |
Remark | [090904 pad] Annotated this feature based on published data. | Paper_evidence | WBPaper00034747 | ||
Method | segmental_duplication |