WormBase Tree Display for Feature: WBsf040348
expand all nodes | collapse all nodes | view schema
| WBsf040348 | SMap | S_parent | Sequence | Y54G2A |
|---|---|---|---|---|
| Name | Other_name | CL-1474_2 | ||
| Sequence_details | Flanking_sequences | AAATGGTCATCATCAAGCGGCATCAATGTT | TCGATTCCAAACCTTCGAAAATATCGATTT | |
| Mapping_target | Y54G2A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Polymorphic segmental duplication as defined by the tool OrthoCluster. This feature represents one sequence from a pair of duplicons in the N2 genome. | ||
| SO_term | SO:1000038 | |||
| Defined_by | Defined_by_paper | WBPaper00034747 | ||
| Defined_by_analysis | Vergara_OrthoCluster_duplication | |||
| Associations | Associated_with_Feature | WBsf040340 | ||
| Remark | [090904 pad] Annotated this feature based on published data. | Paper_evidence | WBPaper00034747 | |
| Method | segmental_duplication |
