WormBase Tree Display for Feature: WBsf047506
expand all nodes | collapse all nodes | view schema
| WBsf047506 | SMap | S_parent | Sequence | Y49E10 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ttgaaagctttcataaaattgagctttgttt | tcagtgaaaaaacacagaaatcttcaaaaaa | |
| Mapping_target | Y49E10 | |||
| DNA_text | GTAAATAA | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Transcription factor binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00033449 | ||
| Associations | Associated_with_gene | WBGene00004027 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000052 | |||
| Bound_by_product_of | WBGene00000912 | |||
| Remark | DAF-16 binds to multiple sites in the pie-1 promoter. | |||
| Method | TF_binding_site |
