WormBase Tree Display for Feature: WBsf047657
expand all nodes | collapse all nodes | view schema
| WBsf047657 | SMap | S_parent | Sequence | ZC101 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tatttgaagattttccaaatttcccaaaaat | aaactttttccttctatcctttggttttcta | |
| Mapping_target | ZC101 | |||
| DNA_text | GCATG | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Regulatory motif | ||
| SO_term | SO:0005836 | |||
| Defined_by | Defined_by_paper | WBPaper00027750 | ||
| Associations | Associated_with_gene | WBGene00006787 | ||
| Bound_by_product_of | WBGene00003172 | |||
| Remark | A new, highly conserved, alternative splicing regulatory element of the unc-52 gene, which may play a role in repressing the inclusion of exon 16. | |||
| Method | regulatory_region |
