WormBase Tree Display for Feature: WBsf127993
expand all nodes | collapse all nodes | view schema
| WBsf127993 | SMap | S_parent | Sequence | Y54G2A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | AAAAAATGTAAAAAATACCCCAACTTCCAG | ATCCCAACGTATTCTGCCTTGGCCTTGTCC | |
| Mapping_target | Y54G2A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
| Defined_by | Defined_by_sequence | Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_sl1_IV_2935529_2935530_+_wb170 | ||
| dauer_daf-2_25dC_91hrs_post-L1_bundle_of_reads_supporting_sl1_IV_2935529_2935530_+_wb170 | ||||
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_SL1_IV_2935528_2935529_+_wb170 | ||||
| dauer_daf-2_25dC_91hrs_post-L1_bundle_of_reads_supporting_SL1_IV_2935528_2935529_+_wb170 | ||||
| Defined_by_analysis (15) | ||||
| Remark | Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 4 reads | |||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047635 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085111 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000008.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145480 with 2 reads | ||||
| Method | SL1 |
