WormBase Tree Display for Feature: WBsf129321
expand all nodes | collapse all nodes | view schema
| WBsf129321 | SMap | S_parent | Sequence | Y54G2A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | GCAATTACCGATAAAAAATTTTTAATTCAG | ATTTCTGCAAACATGGACTCGAAGCCACTC | |
| Mapping_target | Y54G2A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL2 defined by RNASeq short reads (Hillier et al.) | ||
| Defined_by | Defined_by_sequence (11) | |||
| Defined_by_analysis | RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001872 | 1 | ||
| RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 | 1 | |||
| RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 | 2 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 | 1 | |||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 | 1 | |||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001872 with 1 reads | |||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 1 reads | ||||
| Method | SL2 |
