WormBase Tree Display for Feature: WBsf242699
expand all nodes | collapse all nodes | view schema
WBsf242699 | SMap | S_parent | Sequence | C52E12 | ||
---|---|---|---|---|---|---|
Sequence_details | Flanking_sequences | TTTTTTTCAAAATGAATCGATATGCTTTAT | ATTTCATTTCAGCATCGTCTATTTTCACAA | |||
Mapping_target | C52E12 | |||||
Source_location | 190 | CHROMOSOME_II | 7010563 | 7010564 | ||
Origin | Species | Caenorhabditis elegans | ||||
Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
polyA site | ||||||
SO_term | SO:0000553 | |||||
Defined_by | Defined_by_sequence | elegans_PE_SS_GG7297|c4_g1_i1 | Inferred_automatically | make_missing_tsl_features.pl | ||
elegans_PE_SS_GG7297|c4_g1_i2 | Inferred_automatically | make_missing_tsl_features.pl | ||||
elegans_PE_SS_GG7297|c4_g1_i4 | Inferred_automatically | make_missing_tsl_features.pl | ||||
elegans_PE_SS_GG7297|c4_g1_i5 | Inferred_automatically | make_missing_tsl_features.pl | ||||
elegans_PE_SS_GG7297|c4_g1_i6 | Inferred_automatically | make_missing_tsl_features.pl | ||||
elegans_PE_SS_GG7297|c4_g1_i9 | Inferred_automatically | make_missing_tsl_features.pl | ||||
Defined_by_paper | WBPaper00037808 | |||||
WBPaper00037948 | ||||||
Defined_by_analysis | RNASeq_Fire.all_stages_ssRNALigSeq | |||||
Associations | Associated_with_transcript | C52E12.2a.1 | ||||
C52E12.2b.1 | ||||||
Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
Bartel data confident_cleavagesite score: 903.0 | ||||||
Method | polyA_site |