WormBase Tree Display for Feature: WBsf305919
expand all nodes | collapse all nodes | view schema
WBsf305919 | SMap | S_parent | Sequence | F26E4 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | GAGAGAGAATACGAGCGATTGAGAAGCGAA | TTTAATTTAACCCTATTTCAATAAGGCCAC | |
Mapping_target | F26E4 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | LIN-15B Binding Peaks in L4 larva from strain OP184 | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00037946 | ||
WBPaper00035968 | ||||
Defined_by_analysis | modENCODE_3078_Snyder_TF_LIN-15B | |||
Score | 0 | |||
Associations | Associated_with_transcription_factor | WBTranscriptionFactor000008 | ||
Bound_by_product_of | WBGene00023497 | |||
Remark | [120612 gw3] This is a modENCODE project from the Snyder Lab to find TF binding site regions by using ChIP-SEQ immunoprecipitation using an antibody to the TF or to PolII and then sequencing on a Solexa GA2 machine. | |||
Method | TF_binding_site_region |