WormBase Tree Display for Feature: WBsf397530
expand all nodes | collapse all nodes | view schema
| WBsf397530 | SMap | S_parent | Sequence | CHROMOSOME_III |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | CCATTTGTTGTACGTGTCGTACTCATTTAC | TAATATGTTTGGCACAGATATGGACCGGAC | |
| Mapping_target | CHROMOSOME_III | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | C01B12.2 Binding Peaks in L2 larva from strain OP343 | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00037946 | ||
| WBPaper00035968 | ||||
| Defined_by_analysis | modENCODE_3371_Snyder_TF_C01B12.2 | |||
| Score | 1.2e-05 | |||
| Associations | Associated_with_transcription_factor | WBTranscriptionFactor000736 | ||
| Bound_by_product_of | WBGene00015285 | |||
| Remark | [120612 gw3] This is a modENCODE project from the Snyder Lab to find TF binding site regions by using ChIP-SEQ immunoprecipitation using an antibody to the TF or to PolII and then sequencing on a Solexa GA2 machine. | |||
| Method | TF_binding_site_region |
