WormBase Tree Display for Feature: WBsf622184
expand all nodes | collapse all nodes | view schema
| WBsf622184 | SMap | S_parent | Sequence | Y54G2A | ||
|---|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | acgttgtattacgaaatatataattatttt | acattgttttattacatttcaaatcaaaat | |||
| Mapping_target | Y54G2A | |||||
| Source_location | 190 | CHROMOSOME_IV | 2839381 | 2839382 | ||
| Origin | Species | Caenorhabditis elegans | ||||
| Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
| polyA site | ||||||
| SO_term | SO:0000553 | |||||
| Defined_by | Defined_by_paper | WBPaper00037808 | ||||
| Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
| Bartel data confident_cleavagesite score: 13.0 | ||||||
| Method | polyA_site |
