WormBase Tree Display for Feature: WBsf624715
expand all nodes | collapse all nodes | view schema
WBsf624715 | SMap | S_parent | Sequence | R13A1 | ||
---|---|---|---|---|---|---|
Sequence_details | Flanking_sequences | ttttaatgttctaaataaagttttttttgt | aaacttttctgacaatttcaaggcatatct | |||
Mapping_target | R13A1 | |||||
Source_location | 190 | CHROMOSOME_IV | 7206938 | 7206937 | ||
Origin | Species | Caenorhabditis elegans | ||||
Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
polyA site | ||||||
SO_term | SO:0000553 | |||||
Defined_by | Defined_by_paper | WBPaper00037808 | ||||
Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
Bartel data confident_cleavagesite score: 44.0 | ||||||
Method | polyA_site |