WormBase Tree Display for Feature: WBsf644575
expand all nodes | collapse all nodes | view schema
| WBsf644575 | SMap | S_parent | Sequence | F35H8 |
|---|---|---|---|---|
| Name | Public_name | MCP_0000009847 | ||
| Sequence_details | Flanking_sequences | ctccctctatccctctctattttcaccaac | tttttgctggcggttcgcgctttttgaagc | |
| Mapping_target | F35H8 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Clustered region of TSS sites. Number of tags=15. Shape score=0.266667. Assignement type=wormbase_tss. Mode position in cluster=21. | ||
| SO_term | SO:0001240 | |||
| Defined_by | Defined_by_paper | WBPaper00042246 | ||
| Score | 15 | |||
| Associations | Associated_with_gene | WBGene00197031 | ||
| Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
| Method | TSS_region |
