WormBase Tree Display for Feature: WBsf646254
expand all nodes | collapse all nodes | view schema
WBsf646254 | SMap | S_parent | Sequence | T13F2 |
---|---|---|---|---|
Name | Public_name | MCP_0000020561 | ||
Sequence_details | Flanking_sequences | ccgtaatcgggcgcgaaagtattcgaattt | aaaatgaatcatctcaacgaaaacacccaa | |
Mapping_target | T13F2 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Clustered region of TSS sites. Number of tags=31. Shape score=0.193548. Assignement type=wormbase_tss. Mode position in cluster=84. | ||
SO_term | SO:0001240 | |||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Score | 31 | |||
Associations | Associated_with_gene | WBGene00011746 | ||
Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
Method | TSS_region |