WormBase Tree Display for Feature: WBsf655019
expand all nodes | collapse all nodes | view schema
| WBsf655019 | SMap | S_parent | Sequence | H06H21 |
|---|---|---|---|---|
| Name | Public_name | MCP_0000018688 | ||
| Sequence_details | Flanking_sequences | tgcgatagcaaaccccgcccacttttctgt | ttttgtttatttttgtcgattgacgacata | |
| Mapping_target | H06H21 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Clustered region of TSS sites. Number of tags=77. Shape score=0.766234. Assignement type=raft_to_wormbase_tss. Mode position in cluster=26. | ||
| SO_term | SO:0001240 | |||
| Defined_by | Defined_by_paper | WBPaper00042246 | ||
| Score | 77 | |||
| Associations | Associated_with_gene | WBGene00019162 | ||
| Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
| Method | TSS_region |
