WormBase Tree Display for Feature: WBsf658650
expand all nodes | collapse all nodes | view schema
WBsf658650 | SMap | S_parent | Sequence | Y48G9A |
---|---|---|---|---|
Name | Public_name | MCP_0000012418 | ||
Sequence_details | Flanking_sequences | ctgcctgtatgtgttgcgttattgagcggc | ggcgggaattttggaaggcggagcgtaaga | |
Mapping_target | Y48G9A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Clustered region of TSS sites. Number of tags=34. Shape score=0.117647. Assignement type=transcript_body. Mode position in cluster=16. | ||
SO_term | SO:0001240 | |||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Score | 34 | |||
Associations | Associated_with_gene | WBGene00021697 | ||
Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
Method | TSS_region |