WormBase Tree Display for Feature: WBsf680055
expand all nodes | collapse all nodes | view schema
WBsf680055 | SMap | S_parent | Sequence | B0280 |
---|---|---|---|---|
Name | Public_name | MCP_0000014559 | ||
Sequence_details | Flanking_sequences | acacacacatacacacacacacatacacac | aatgatcaaaaaagatgtaaatgtaaaggt | |
Mapping_target | B0280 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Clustered region of TSS sites. Number of tags=5. Shape score=0.6. Assignement type=unassigned. Mode position in cluster=2. | ||
SO_term | SO:0001240 | |||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Score | 5 | |||
Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
Method | TSS_region |