WormBase Tree Display for Feature: WBsf698107
expand all nodes | collapse all nodes | view schema
WBsf698107 | SMap | S_parent | Sequence | C07D10 |
---|---|---|---|---|
Name | Public_name | MCM_0000008404 | ||
Sequence_details | Flanking_sequences | cgttataaataatgaaaaacgaactctggc | ttgtgaatgatgactaaccaagccgttttc | |
Mapping_target | C07D10 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Clustered region of TSS sites. Number of tags=5. Shape score=0.6. Assignement type=unassigned. Mode position in cluster=0. | ||
SO_term | SO:0001240 | |||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Score | 5 | |||
Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
Method | TSS_region |